SubtiWiki SubtiWiki
yrdR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yrdR
168

unknown

locus
BSU_26620
Molecular weight
35.76 kDa
pI
9.97
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yrdR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
2,720,687 → 2,721,652
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 18-146, aa 175-300) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F47A2C0A7478485BDAF90FA873F4B1D1F7C74004|yrdR]-[gene|4E42C126368C8995971518F33933D39FFD52BF64|yrzO]
description
[pubmed|22383849]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [pubmed|30782632], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [pubmed|30782632], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|F47A2C0A7478485BDAF90FA873F4B1D1F7C74004|yrdR]→[gene|4E42C126368C8995971518F33933D39FFD52BF64|yrzO]

2021-11-11 04:01:44

Bzhu

4

f5e8eeb8edcdf1a01bf169172d60652bf980e7da

C596F70DF90BF503D6EC0DFE195EF95B0F69793F

Biological materials
Mutant
MGNA-A860 (yrdR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/860 NBRP B. subtilis, Japan]
BKE26620 (Δ[gene|F47A2C0A7478485BDAF90FA873F4B1D1F7C74004|yrdR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAATTCCCCTCCTTTT,  downstream forward: _UP4_ACTTAGACAGTGGGGGATTT
BKK26620 (Δ[gene|F47A2C0A7478485BDAF90FA873F4B1D1F7C74004|yrdR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAATTCCCCTCCTTTT,  downstream forward: _UP4_ACTTAGACAGTGGGGGATTT

F47A2C0A7478485BDAF90FA873F4B1D1F7C74004

Page visits: 892

Time of last update: 2021-12-28 16:54:20

Author of last update: Melvin.boenninger