yflT

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yflT
168

general stress protein, survival of ethanol stress

locus
BSU_07550
Molecular weight
12.00 kDa
pI
4.806
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
ec
null
synonyms
yflT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
827,455 → 827,802
The protein
Structure
[AF|P80241]
Expression and Regulation
Operons
genes
[gene|9D4B8B6EDF69794135C5937B424B923B32C60B56|yfmA]-[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]
description
[Pubmed|22383849]
Open in new tab

[gene|9D4B8B6EDF69794135C5937B424B923B32C60B56|yfmA]→[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]

2022-05-16 13:33:39

Jstuelk

8

c5d291f275f1f61c6b672c01dc1453d9283bc3dc

3271E3E9CBEFB26471BAB042703D39EB1A806F3B

genes
[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yflT.html DBTBS]) null
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]

2022-05-14 02:52:56

ghost

8

a434fa863f98fef02bf848be87f7a72a2257c9f6

3D9827A257FC3A08F619AE3587334BDA7AC5E102

Biological materials
Mutant
MGNA-C332 (yflT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2330 NBRP B. subtilis, Japan]
BKE07550 (Δ[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGATATTCCTCCTTC,  downstream forward: _UP4_TAAAGCAAGGAAAAAACCAA
BKK07550 (Δ[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGATATTCCTCCTTC,  downstream forward: _UP4_TAAAGCAAGGAAAAAACCAA
References
12107147,15805528

F4C3F9C671B523AF11E8412A196162FEBE6BE923

Page visits: 1411

Time of last update: 2022-05-19 09:04:31

Author of last update: Bzhu