pksG
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

pksG
168

involved in polyketide synthesis

locus
BSU_17150
Molecular weight
46.62 kDa
pI
5.14
Protein length
Gene length
function
polyketide synthesis
product
hydroxymethylglutaryl CoA synthase
essential
no
synonyms
pksG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3425

This gene is a member of the following regulons

Gene
Coordinates
1,789,943 → 1,791,205
The protein
Catalyzed reaction/ biological activity
3-oxobutanoyl-[ACP] + acetyl-[ACP] + H2O --> (3S)-hydroxy-3-methylglutaryl-[ACP] + H+ + holo-[ACP] (according to UniProt)
Protein family
[wiki|thiolase-like superfamily] (according to UniProt)
Structure
[PDB|4YXQ]
[PDB|4YXT] (E82A mutant)
[PDB|4YXV] (C114A mutant)
[AF|P40830]
Expression and Regulation
Operons
genes
[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[Pubmed|22383849]
regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab

[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2022-07-22 00:02:56

Jstuelk

42

74BF817D9000509D225BBBCAC6C8A0A9EABEB843

1475C94AAA2C10C6BE3CA0873EFBD171EC2E2513

genes
[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[pubmed|22383849]
Open in new tab

[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2022-07-22 00:06:58

Jstuelk

37

c851e07b7201353cf026d8929ea66cff6bbb92e2

D95CF77A7673AA84CC653095A1FB017D490049D6

Biological materials
Mutant
MGNA-A017 (pksG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/17 NBRP B. subtilis, Japan]
BKE17150 (Δ[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTTCTATTCCGGCTGAAA,  downstream forward: _UP4_TCTGAGTTTCATCGGAAGTA
BKK17150 (Δ[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCTTCTATTCCGGCTGAAA,  downstream forward: _UP4_TCTGAGTTTCATCGGAAGTA
References
23840410,22383849,24187085,27766092

F4C96980640CB04D3017B8EBB02918006CBCF7BB

Page visits: 1710

Time of last update: 2022-08-07 10:22:49

Author of last update: Melvin.boenninger