yebC

yebC
168

unknown

locus
BSU_06380
Molecular weight
30.47 kDa
pI
9.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yebC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
696,195 → 696,998
The protein
Structure
[AF|O34341]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]
description
[Pubmed|21815947]
regulation
expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV] mutant [Pubmed|21926231]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]

2022-11-26 12:44:07

Bzhu

11

fe444aea802da59ddeaa3dfcfbb9d21aa2ee1657

1786C4A2B319AAD9427B1EDF12719215C6C69B46

Biological materials
Mutant
MGNA-A919 (yebC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/919 NBRP B. subtilis, Japan]
BKE06380 (Δ[gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAACTCCTATCA,  downstream forward: _UP4_TAATGAAAAAACCGGCTAAT
BKK06380 (Δ[gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAACTCCTATCA,  downstream forward: _UP4_TAATGAAAAAACCGGCTAAT
References
21926231,21815947

F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2

Page visits: 1422

Time of last update: 2022-12-06 05:52:50

Author of last update: Melvin.boenninger