SubtiWiki SubtiWiki
yceG

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yceG
168

general stress protein, survival of ethanol stress

locus
BSU_02930
Molecular weight
62.60 kDa
pI
5.96
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
ec
null
synonyms
yceG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
314,883 → 316,496
Phenotypes of a mutant
more sensitive to nisin [Pubmed|23980836]
Expression and Regulation
Operons
genes
[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
description
[Pubmed|11866510]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]→[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]

2021-11-18 10:45:44

ghost

4

1557da8d91643a69a9cc817172bc649767baab90

35ADA58FA11FB35C1D0420A579F4F2F0CD877167

Biological materials
Mutant
BKE02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG,  downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
BKK02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG,  downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
References
15805528,11866510,18179421,23980836

F588108F12C5CA855A24159F28223EF67145D28F

Page visits: 1436

Time of last update: 2022-01-03 21:27:36

Author of last update: Bzhu