

similar to transcriptional repressor ([wiki|MarR family])

Molecular weight
20.28 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

1,124,438 → 1,124,965
The protein
Protein family
[wiki|MarR family]
[wiki|HTH marR-type domain] (aa 10-157) (according to UniProt)
Paralogous protein(s)
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Open in new tab


2022-06-21 05:00:43





Open in new tab


2022-06-26 06:26:22





Biological materials
MGNA-A722 (yhjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/722 NBRP B. subtilis, Japan]
BKE10510 (Δ[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGGTTTTCCATCCTTT,  downstream forward: _UP4_TAAAAAACACGCACTGCGGT
BKK10510 (Δ[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGGTTTTCCATCCTTT,  downstream forward: _UP4_TAAAAAACACGCACTGCGGT


Page visits: 1518

Time of last update: 2022-06-28 07:05:39

Author of last update: Melvin.boenninger