SubtiWiki SubtiWiki
yhjH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhjH
168

similar to transcriptional repressor ([wiki|MarR family])

locus
BSU_10510
Molecular weight
20.28 kDa
pI
7.39
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhjH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
1,124,438 → 1,124,965
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 10-157) (according to UniProt)
Paralogous protein(s)
[protein|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]-[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]
description
[Pubmed|22383849]
Open in new tab

[gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]→[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]

2021-11-15 18:06:55

Jstuelk

4

0867e77afe92a57a0fbf01a12c6f7bffcb03939d

2287EB9D4D4F853F0850E7DF346830CC60D49B88

genes
[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]
description
[Pubmed|22383849]
Open in new tab

[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]

2021-05-30 05:25:46

Jstuelk

2

cd925a3c9efc9017255d2f08f778270b8e4e3baa

FA98670506DAED2714FA5E1FC292A8A90326A480

Biological materials
Mutant
MGNA-A722 (yhjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/722 NBRP B. subtilis, Japan]
BKE10510 (Δ[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGGTTTTCCATCCTTT,  downstream forward: _UP4_TAAAAAACACGCACTGCGGT
BKK10510 (Δ[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGGTTTTCCATCCTTT,  downstream forward: _UP4_TAAAAAACACGCACTGCGGT

F5A59CE7727E0851652BB4C0144009154AB4978B

Page visits: 1373

Time of last update: 2022-01-21 16:45:29

Author of last update: Melvin.boenninger