ycgA

ycgA
168

unknown

locus
BSU_03020
Molecular weight
41.37 kDa
pI
8.24
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycgA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1288

This gene is a member of the following regulons

Gene
Coordinates
325,339 → 326,772
The protein
Structure
[AF|P55908]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]
description
[pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|12618455]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]

2022-11-25 17:11:37

Jstuelk

27

4e501c0bd12a6f620b9fea9b6280e9e0029eda7a

D1953F0B72D5528B7EB9D74B38DE900A75CCFDE2

Biological materials
Mutant
MGNA-B987 (ycgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1986 NBRP B. subtilis, Japan]
BKE03020 (Δ[gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCGATCCATCCCCT,  downstream forward: _UP4_TAACGATTGCTGCCCGCCGG
BKK03020 (Δ[gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCGATCCATCCCCT,  downstream forward: _UP4_TAACGATTGCTGCCCGCCGG
References
12884008,12618455,12618455

F71FBBE4436FBC4221C3631794C73D306CD3FC7E

Page visits: 1223

Time of last update: 2022-12-01 20:48:15

Author of last update: Melvin.boenninger