SubtiWiki SubtiWiki
yczL

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yczL
168

unknown

locus
BSU_03359
Molecular weight
6.70 kDa
pI
10.291
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
yczL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
365,850 → 366,035
Expression and Regulation
Operons
genes
[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
description
[Pubmed|25649915]
regulation
''[wiki|folE2]'': induced by zinc starvation ([protein|search|Zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]→[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]

2021-11-13 20:52:10

ghost

3

f1a9da8a2145cd33659ba3d54e0d9a81c7389ae4

11D924483BF509F89BDCD36CAA9727DC5156792B

genes
[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
description
[Pubmed|9811636]
regulation
[wiki|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]→[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]

2022-01-12 11:34:09

Jstuelk

22

ad7d4075bafccef586e192b5f9b59ca4750bd357

154D780A688DFF455944F618E9A71FDF4E6BA39E

Biological materials
Mutant
BKE03359 (Δ[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03359 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGATGCACAGACAATGA,  downstream forward: _UP4_TAATCATTCTATTTTAATGG
BKK03359 (Δ[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03359 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGATGCACAGACAATGA,  downstream forward: _UP4_TAATCATTCTATTTTAATGG

F735802BB483C2C5437240AB2E9FC340EAA5B353

Page visits: 818

Time of last update: 2022-01-18 19:43:55

Author of last update: Bzhu