dacF

dacF
168

Class C penicillin-binding protein I, D-alanyl-D-alanine carboxypeptidase

locus
BSU_23480
Molecular weight
43.13 kDa
pI
9.91
Protein length
Gene length
function
control of peptide cross-linking in spore peptidoglycan
product
penicillin-binding protein I, D-alanyl-D-alanine carboxypeptidase
essential
no
synonyms
dacF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1686

This gene is a member of the following regulons

Gene
Coordinates
2,445,094 → 2,446,263
The protein
Catalyzed reaction/ biological activity
modifies degree of cross-linking of glycan strands in peptidoglycan [pubmed|9864321]
Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
Protein family
[wiki|Peptidase S11 family] (according to UniProt)
Structure
[PDB|4K91] (from Pseudomonas aeruginosa, 38% identity) [pubmed|23629710]
[AF|P38422]
Paralogous protein(s)
[protein|7C3081BC8D416127A881627EB56C0628359111CF|dacA], [protein|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]
[wiki|Localization]
secreted (via signal peptide) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]-[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2023-02-06 13:36:47

ghost

60

3937ee398a65a809f372c4c59231b1d2e3c32629

AEBA18A2591E8C2953E0D2D62B0F6CD480E5CB2B

Biological materials
Mutant
BKE23480 (Δ[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAAGCCCTCCATT,  downstream forward: _UP4_TAATTATGCCGAATGACCAC
BKK23480 (Δ[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAAGCCCTCCATT,  downstream forward: _UP4_TAATTATGCCGAATGACCAC
References
Reviews
18266855,33709487,35638784
Original Publications
16497325,8936302,9864321,12107147,20817675,22123250,23629710,32419322

F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1

Page visits: 2572

Time of last update: 2023-02-06 12:19:36

Author of last update: Jstuelk