SubtiWiki SubtiWiki
yfkM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfkM
168

glyoxalase III-like enzyme, general stress protein, survival of salt, paraquat and ethanol stresses

locus
BSU_07850
Molecular weight
18.72 kDa
pI
4.72
Protein length
Gene length
function
detoxification of methylglyoxal
product
glyoxalase III-like enzyme
essential
no
synonyms
yfkM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0693

This gene is a member of the following regulons

Gene
Coordinates
859,745 → 860,263
The protein
Catalyzed reaction/ biological activity
methylglyoxal -→ D-lactate [Pubmed|24330391]
Protein family
[wiki|peptidase C56 family] (according to UniProt)
[wiki|Domains]
[wiki|PfpI endopeptidase domain] (aa 3-171) (according to UniProt)
Structure
[PDB|1OI4] (from E. coli, 64% identity)
Paralogous protein(s)
[protein|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]
Expression and Regulation
Operons
genes
[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]
description
[Pubmed|12354229]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]

2021-07-27 11:58:53

ghost

3

d8b48533bfddd4eeb1ccf3886b2e5ccca129911c

D95D8F63663CF11F9CF009F2D155923438D29B8C

Biological materials
Mutant
MGNA-C264 (yfkM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2262 NBRP B. subtilis, Japan]
BKE07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC,  downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
BKK07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC,  downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
References
10220166,24330391,12354229,15805528,22582280

F88F0153CAFC1E51F2586F733AFDF22320642151

Page visits: 2155

Time of last update: 2022-01-24 21:31:36

Author of last update: Melvin.boenninger