fur

fur
168

transcription regulator of iron homoeostasis, sensor of Fe sufficiency

locus
BSU_23520
Molecular weight
17.26 kDa
pI
5.37
Protein length
Gene length
function
regulation of iron homoeostasis
product
transcriptional repressor [wiki|Fur family]
essential
no
synonyms
fur, yqkL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0735

This gene is a member of the following regulons

Gene
Coordinates
2,449,841 → 2,450,290
Phenotypes of a mutant
no growth with glucose and ammonium as single sources of carbon and nitrogen, respectively (due to [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]-mediated repression of the ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]'' operon)  [Pubmed|22389480]
poor growth on lactate as single carbon source (due to overexpression of [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]-mediated repression of the ''[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]'' operon, can be suppressed by inactivation of ''[gene|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]'' or ''[gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]'')  [Pubmed|22427629]
severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C [pubmed|36312962]
transcription profile of a ''[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]'' mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27416 GEO] [Pubmed|22389480]
The protein
Protein family
[wiki|Fur family] (according to UniProt)
[wiki|Cofactors]
Fe2+ [pubmed|28938859]
Structure
[PDB|4ETS] (from Campylobacter jejuni, 33% identity) [pubmed|22665794]
[AF|P54574]
Effectors of protein activity
DNA binding activity (repression) is triggered by binding of Fe2+ [Pubmed|23057863]
Paralogous protein(s)
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR], [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]
description
[Pubmed|12029044]
regulation
repressed in the absence of hydrogen peroxide ([protein|search|PerR]) [Pubmed|12029044]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|12029044], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12029044], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]

2022-12-31 02:46:32

ghost

32

76a1538af3a96cec1f7c2f8fe73ba147530dcd91

91526BF0BCC64D1B1944F623E65CB9D16B698BD2

Biological materials
Mutant
GP879 ([gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::''mls'') and GP868 ([gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::''mls'', [gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]::''spc''), available in [wiki|Jörg Stülke]'s lab
GP3321 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::''mls'' Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::''cat''), available in [wiki|Jörg Stülke]'s lab
HB6543 (aphA3), available in the [wiki|John Helmann]'s lab
MGNA-C426 (fur::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2424 NBRP B. subtilis, Japan]
1A910 ( ''fur''::''kan''), [Pubmed|12029044], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A910&Search=1A910 BGSC]
BKE23520 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC,  downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
BKK23520 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC,  downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
Expression vectors
pGP3589 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP3592 (based on [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
Reviews
15802251,25209494,25160631,28938859
Other original publications
18487332,14563870,18697947,10400588,11790741,12207695,9701813,12029044,22427629,17725565,17012385,12950915,19508286,16672620,23057863,25486128,28439033,29133393,30377275,22665794,31988078,32949815,36312962
The [wiki|Fur regulon]
12374814,12354229,22389480,21873409,29133393

F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725

Page visits: 4179

Time of last update: 2023-02-02 13:02:51

Author of last update: Rica