bacG

bacG
168

short chain reductase involved in bacilysin synthesis

locus
BSU_37680
Molecular weight
27.87 kDa
pI
6.6
Protein length
Gene length
function
biosynthesis of the antibiotic bacilysin
product
short chain reductase
essential
no
synonyms
bacG, ipa-86r, ywfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
3,867,493 → 3,868,272
The protein
Catalyzed reaction/ biological activity
BacG catalyzes the conjugate addition of hydride at the C4 olefinic terminus using NADH to yield the cyclohexenol- containing tetrahydro-4-hydroxyphenylpyruvate [Pubmed|20052993]
stereoselective reduction of dihydro-hydroxyphenylpyruvate (H2HPP) to tetrahydro-hydroxyphenylpyruvate (H4HPP), NADPH-dependent reductase that facilitates the conjugate addition of a hydride at the C(4) olefin terminus of H2HPP [Pubmed|23519407]
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
[wiki|Cofactors]
NADPH [Pubmed|23519407]
Structure
[PDB|3U49] [Pubmed|23519407]
[AF|P39644]
Expression and Regulation
Operons
genes
[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]
description
[Pubmed|12372825]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]

2022-11-15 12:36:19

ghost

14

25c148014fadf87dc8230d25050c765698853a8e

F1A5D3A777C41135EC339ED562DB033947D195F0

Biological materials
Mutant
MGNA-A515 (ywfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/515 NBRP B. subtilis, Japan]
BKE37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG,  downstream forward: _UP4_AGCATATAAAAACATCCCGC
BKK37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG,  downstream forward: _UP4_AGCATATAAAAACATCCCGC
References
12372825,12107147,20052993,21948839,23519407

F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C

Page visits: 2257

Time of last update: 2022-12-01 09:09:42

Author of last update: Jstuelk