SubtiWiki SubtiWiki
ydjG

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydjG
168

required for membrane localization of [protein|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI] and [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA] upon stress

locus
BSU_06190
Molecular weight
38.17 kDa
pI
5.38
Protein length
Gene length
function
targeting of [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]
product
unknown
essential
no
ec
null
synonyms
ydjG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1996

This gene is a member of the following regulons

Gene
Coordinates
671,994 → 673,019
Phenotypes of a mutant
strong defect in cell morphology upon alkali stress [pubmed|34777311]
The protein
[wiki|Localization]
cell membrane [pubmed|34777311]
Expression and Regulation
Operons
genes
[gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]-[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]-[gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]-[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]
description
[Pubmed|11454200]
regulation
induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696,20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11454200], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]→[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]

2022-01-13 02:26:06

ghost

13

acd856a9b4c4f4245876a78e553b66cc82aec883

3D530E75D1E9015D6307195E2B09B3BA2A30E2FA

Biological materials
Mutant
BKE06190 (Δ[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACCGTTCCCTCTCACA,  downstream forward: _UP4_TTGATGATGGGAGGCGGATT
BKK06190 (Δ[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACCGTTCCCTCTCACA,  downstream forward: _UP4_TTGATGATGGGAGGCGGATT
References
11454200,18840696,34777311

F93381205C61665820D034A384BD60410AAE84C1

Page visits: 1251

Time of last update: 2022-01-06 00:15:23

Author of last update: Jstuelk