cstA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

cstA
168

similar to pyruvate transporter, carbon starvation-induced protein

locus
BSU_28710
Molecular weight
64.19 kDa
pI
8.66
Protein length
Gene length
function
uptake of pyruvate
product
putative pyruvate transporter, carbon starvation-induced protein
essential
no
synonyms
cstA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1966

This gene is a member of the following regulons

Gene
Coordinates
2,936,382 → 2,938,178
The protein
Catalyzed reaction/ biological activity
pyruvate:H+ symport [pubmed|29061664]
Protein family
peptide transporter carbon starvation (CstA) (TC 2.A.114) family (single member, according to UniProt)
Structure
[AF|P94532]
[wiki|Localization]
membrane (according to [http://www.uniprot.org/uniprot/P94532 UniProt])
Expression and Regulation
Operons
genes
[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]-[gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]
description
[Pubmed|22383849]
regulation
repressed by glucose (3.4-fold) ([protein|search|CcpA]) [Pubmed|12850135,22900538]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22900538], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]→[gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]

2022-05-24 07:35:32

ghost

12

a577bd6c8262be9f7d56b55c40224b64a4df7fad

EBDDE99EDA22F3E4F409318C0A1210115C8AD2D2

Biological materials
Mutant
MGNA-B012 (cstA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1011 NBRP B. subtilis, Japan]
BKE28710 (Δ[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCCATCCCCTTT,  downstream forward: _UP4_TAGAAGGACTATTGAAAATG
BKK28710 (Δ[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCCATCCCCTTT,  downstream forward: _UP4_TAGAAGGACTATTGAAAATG
References
The ''E. coli'' homolog
1848300,29061664,33260635

F93E473C06669DE604EC027236C79E5450F53720

Page visits: 1173

Time of last update: 2022-05-24 23:22:58

Author of last update: Jstuelk