rplK

rplK
168

ribosomal protein uL11, recruitment of [protein|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH] to the 50S subunit of stalled ribosomes

locus
BSU_01020
Molecular weight
14.78 kDa
pI
9.72
Protein length
Gene length
function
translation
product
ribosomal protein L11 (uL11)
essential
no
synonyms
rplK, relC, tsp

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0080

This gene is a member of the following regulons

Gene
Coordinates
118,591 → 119,016
Phenotypes of a mutant
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
defective in ribosome quality control [pubmed|34255840]
The protein
Catalyzed reaction/ biological activity
recruitment of [protein|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH] to the 50S subunit of stalled ribosomes [pubmed|34255840]
Protein family
Universal [wiki|ribosomal protein] uL11 family (single member, according to UniProt)
Structure
[PDB|2FOW] (RNA binding domain in complex with RNA, Geobacillus stearothermophilus)
[PDB|1FOX] (C-terminal domain, Geobacillus stearothermophilus)
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
[AF|Q06796]
Modification
phosphorylated on Arg-94 [Pubmed|22517742]
[wiki|Localization]
[wiki|ribosome] (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]-[gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]-[gene|E4D89640D0F0A31A2814D20FB5425FDB0B46A43D|BSU_misc_RNA_3]-[gene|5EF3A7953AA97D2B44C967542A53FEA7F36D7BA3|rplJ]-[gene|E72910604D3DC2A62AE8A951F55570EA2838B250|rplL]
description
[pubmed|22383849]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, [pubmed|11948165], in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]->[gene|E72910604D3DC2A62AE8A951F55570EA2838B250|rplL]

2022-11-24 22:27:08

Jstuelk

26

a3b77f9cd37eef4d41bc80e15b9131374c283aa8

9D93F55A2AB271535602470E50EFA15E2E175400

Biological materials
Mutant
BKE01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA,  downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
BKK01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA,  downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
References
11244072,11948165,19653700,20441189,20525796,22517742,112097,23002217,25903689,28516784,28189581,33259811,33753464,34255840

F94A1C14912F35ADB4C611AA17D55268CC26160D

Page visits: 2847

Time of last update: 2022-11-27 04:09:23

Author of last update: Jstuelk