SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


aldehyde dehydrogenase (NAD), general stress protein, required for protection against paraquat stress

Molecular weight
52.65 kDa
Protein length
Gene length
stress resistance
aldehyde dehydrogenase (NAD)
aldY, yxkE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

3,986,428 → 3,987,885
The protein
Catalyzed reaction/ biological activity
aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Paralogous protein(s)
[protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX]
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|10482513]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab


2021-12-04 12:56:50





Biological materials
MGNA-B739 (aldY::erm), available at the [ NBRP B. subtilis, Japan]
BKE38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG,  downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
BKK38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG,  downstream forward: _UP4_TAAATGAAAAAATCCCTCTG


Page visits: 2168

Time of last update: 2022-01-18 14:15:01

Author of last update: Melvin.boenninger