aldY

aldY
168

aldehyde dehydrogenase (NAD), general stress protein, required for protection against paraquat stress

locus
BSU_38830
Molecular weight
52.65 kDa
pI
5.02
Protein length
Gene length
function
stress resistance
product
aldehyde dehydrogenase (NAD)
essential
no
synonyms
aldY, yxkE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
3,986,428 → 3,987,885
The protein
Catalyzed reaction/ biological activity
aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Structure
[PDB|4DNG]
[AF|P94358]
Paralogous protein(s)
[protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX]
Expression and Regulation
Operons
genes
[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]
description
[Pubmed|10482513]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|10482513]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]

2022-06-21 05:50:37

ghost

10

b944303d0c1f91240f963eeb664bc7c6ac8a37b2

C0D47C85C745E8299BF97F7CCD6528F923FBF170

Biological materials
Mutant
MGNA-B739 (aldY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1738 NBRP B. subtilis, Japan]
BKE38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG,  downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
BKK38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG,  downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
References
15805528,10482513,22582280

F9CF067A2A8E3B2BACC6A51A0E87E84640349980

Page visits: 2323

Time of last update: 2022-10-06 07:23:21

Author of last update: Melvin.boenninger