SubtiWiki SubtiWiki
yogA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yogA
168

similar to alcohol dehydrogenase

locus
BSU_18430
Molecular weight
35.66 kDa
pI
8.05
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yogA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0604

This gene is a member of the following regulons

Gene
Coordinates
2,007,526 → 2,008,515
The protein
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
Structure
[PDB|2EIH] (36% identity)
Additional information
The gene is annotated in KEGG as an ortholog of alcohol dehydrogenase EC 1.1.1.1. No annotation is available in Swiss-Prot. The protein is marked in MetaCyc as “similar to alcohol dehydrogenase”. No evidence supporting the annotation is available. [Pubmed|19935659]
Expression and Regulation
Operons
genes
[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]
description
[Pubmed|22383849]
Open in new tab

[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]

2020-11-06 12:56:32

ghost

0

10674f512f7f951efd9f44a86de7af04333a3531

310E2919935F5B69F4BAC335A06D82F99AB18A56

Biological materials
Mutant
MGNA-B088 (yogA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1087 NBRP B. subtilis, Japan]
BKE18430 (Δ[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCTGCCTCCTCAT,  downstream forward: _UP4_TAAAAAAAGAAACCGGCTGG
BKK18430 (Δ[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCTGCCTCCTCAT,  downstream forward: _UP4_TAAAAAAAGAAACCGGCTGG
References
22383849

F9DC5EEF3E9BA8F04F401A183340C475B9058B38

Page visits: 607

Time of last update: 2021-04-10 13:31:35

Author of last update: Jstuelk