ymfC

ymfC
168

similar to transcriptional regulator ([wiki|GntR family])

locus
BSU_16810
Molecular weight
27.75 kDa
pI
6.4
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|GntR family])
essential
no
synonyms
ymfC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2188

This gene is a member of the following regulons

Gene
Coordinates
1,754,785 → 1,755,510
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 8-76) (according to UniProt)
Structure
[PDB|2WV0] ([protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR], corresponds to aa 83 ... 307 of YmfC, 30% identity)
[AF|O31761]
Expression and Regulation
Operons
genes
[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]
description
[pubmed|22383849]
Open in new tab

[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]

2022-11-28 22:24:34

Jstuelk

15

3b1aca4ad05a750c220e5f1574fa4177d96220a1

1BB27394B9DC7B63DE90D5D63A002879C94B9D14

genes
[gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]-[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507870], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|125325B485FBC60798EDA4B4BFB24C6FCBC4C513|spoIIIE]→[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]

2022-11-30 18:20:35

Jstuelk

27

20931424e7f3957a516f01163ac7a07a7038a992

7D54335218ECF5D963FC72675848DF5C0DA67794

Biological materials
Mutant
MGNA-B115 (ymfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1114 NBRP B. subtilis, Japan]
BKE16810 (Δ[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCCTCCGTAAAC,  downstream forward: _UP4_TAAAAACGGACGCCTGTATG
BKK16810 (Δ[gene|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCCTCCGTAAAC,  downstream forward: _UP4_TAAAAACGGACGCCTGTATG
References
23504016,20047956

F9E0C645BCCD9A299E951D0574321C1FACA8DE4C

Page visits: 1031

Time of last update: 2022-12-05 03:04:21

Author of last update: Melvin.boenninger