nasD

nasD
168

assimilatory nitrite reductase (subunit)

locus
BSU_03300
Molecular weight
88.24 kDa
pI
4.95
Protein length
Gene length
function
utilization of nitrite as nitrogen source
product
assimilatory nitrite reductase (subunit)
essential
no
ec
1.7.1.4
synonyms
nasD, nasBC, nirB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1251

This gene is a member of the following regulons

Gene
Coordinates
355,764 → 358,181
The protein
Catalyzed reaction/ biological activity
2 H2O + 3 NADP+ + NH4+ --> 5 H+ + 3 NADPH + nitrite (according to UniProt)
2 H2O + 3 NAD+ + NH4+ --> 5 H+ + 3 NADH + nitrite (according to UniProt)
Protein family
nitrite and sulfite reductase 4Fe-4S domain family (with [protein|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI], according to UniProt)
[wiki|Cofactors]
Fe-S cluster  [Pubmed|11289299]
FAD  [Pubmed|11289299]
Structure
[PDB|3KLJ] (from Clostridium acetobutylicum, corresponds to aa 5 ... 399, 32% identity) [pubmed|20017214]
[AF|P42435]
Paralogous protein(s)
[protein|3F87227DC3371746B3823730B6A7024D348C151E|nasB]
Expression and Regulation
Operons
genes
[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|7836289]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10972836], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [PubMed|8799114,9765565], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]: repression, [Pubmed|16885456], in [regulon|protein:EC6697D5D945B7E5083AFED9218748763C443278|nsrR regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7836289], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-28 20:04:48

ghost

35

f7e39891ce616efe86a59a87e70448f347bb9239

B3FDABF6DE6A38B053CBE30BA36088850B35E312

genes
[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|9765565]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
Open in new tab

[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-29 17:14:30

ghost

25

5ad87c79ecdfd1b1041c676834950d8393689a20

E10C8C0393696A6DF68E202566914889ADC48A5C

Biological materials
Mutant
1A973 ( ''nasD''::''phleo''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A973&Search=1A973 BGSC]
BKE03300 (Δ[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGATGATCCGCTCCTT,  downstream forward: _UP4_TAATGACAAAAACTATCATT
BKK03300 (Δ[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGATGATCCGCTCCTT,  downstream forward: _UP4_TAATGACAAAAACTATCATT
References
Reviews
22103536,11289299
Original Publications
12823818,7868621,8799114,9765565,10972836,16885456,21091510,24214949,25755103,28439033,20017214,34898263

FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23

Page visits: 1978

Time of last update: 2022-11-30 10:05:45

Author of last update: Jstuelk