licT

licT
168

transcriptional antiterminator of the [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]-[gene|search|yxiE ]operon and the [gene|search|bglS ]gene

locus
BSU_39080
Molecular weight
32.22 kDa
pI
5.94
Protein length
Gene length
function
control of beta-glucan and beta-glucoside utilization
product
transcriptional antiterminator (BglG family)
essential
no
synonyms
licT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711

This gene is a member of the following regulons

Gene
Coordinates
4,012,866 → 4,013,699
Phenotypes of a mutant
no expression of the [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH] operon
The protein
Catalyzed reaction/ biological activity
binding to the mRNAs of ''[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]'' and the ''[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]'' operon, causes transcription antitermination (in presence of salicin and absence of glucose)
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
N-terminal RNA binding domain [Pubmed|10610766]
2 x [wiki|PRD] ([wiki|PTS] regulation domains) [Pubmed|11447120]
2 [wiki|PRD] domains (aa 65-170, aa 171-277) (according to UniProt)
Structure
[PDB|1H99] ([wiki|PRD]s) [pubmed|11447120]
[PDB|1L1C] (complex with RAT) [pubmed|11953318]
[AF|P39805]
Modification
phosphorylation at His-100 in [wiki|PRD]-1 by phosphorylated [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP], inhibits LicT antitermination activity
phosphorylation at His-207 and/or His-269 in [wiki|PRD]-2 by His-P-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr], stimulates LicT antitermination activity
Paralogous protein(s)
[protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]
[wiki|Localization]
cytoplasm, even distribution in the absence of the inducer salicin, subpolar localization in the presence of salicin [Pubmed|23475962]
Expression and Regulation
Operons
genes
[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]
description
[Pubmed|8606172]
regulation
expressed in the stationary phase (temporal activation) [Pubmed|8245830]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8606172], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]→[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]

2022-11-26 22:00:53

ghost

33

c53f5f9d65bee2f49b36b261b08f54a3681748a8

E04D349CE33F16260854D95835D7F11AFB892F8F

genes
[gene|6BC5A936D8EDE7087C3F6293A2873EC5352FE5EF|yxiP]-[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]
description
[Pubmed|22383849]
Open in new tab

[gene|6BC5A936D8EDE7087C3F6293A2873EC5352FE5EF|yxiP]→[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]

2022-11-22 13:02:38

Jstuelk

39

c71d4e27ae884ff063a0224636e47b3376f616d1

E9284413C9C634EA6CE5E83A3A68A4BC61C0C559

Biological materials
Mutant
GP427 (Δ[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::[gene|search|erm]), available in [wiki|Jörg Stülke]'s lab
BKE39080 (Δ[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT,  downstream forward: _UP4_TAATGAGAGCGCTGACATTT
BKK39080 (Δ[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT,  downstream forward: _UP4_TAATGAGAGCGCTGACATTT
Expression vectors
for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP165,  available in [wiki|Jörg Stülke]'s lab
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP315,  available in [wiki|Jörg Stülke]'s lab
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pGP570]: pGP572,  available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1221 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1225, [gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-gfp, spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab [pubmed|23475962]
GP1229, [gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-yfp, spc), available in [wiki|Jörg Stülke]'s lab [pubmed|23475962]
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
[wiki|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
Reviews
9663674,18086213
Original Publications
8606172,23475962,11447120,10610766,7559347,8626332,10048041,11447120,11580842,11733988,12169607,12398354,15699035,17074746,21278164,21335451,28235843,31612430,31753618,33781896,18682383,11953318

FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C

Page visits: 2408

Time of last update: 2022-11-26 04:48:00

Author of last update: Jstuelk