yaaA

yaaA
168

ribosome assembly factor, participates in the assembly of the 50S subunit of the ribosome

locus
BSU_00030
Molecular weight
7.79 kDa
pI
4.33
Protein length
Gene length
function
assembly of the 50S subunit of the ribosome
product
ribosome assembly factor
synonyms
yaaA, , rlbA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2501

This gene is a member of the following regulons

Gene
Coordinates
3,206 → 3,421
Phenotypes of a mutant
enhanced expression suppresses the defects of a temperature-sensitive ''[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]'' mutant [Pubmed|24637032]
the mutant cells are thicker and longer than wild type cells [pubmed|34846166]
The protein
Protein family
[wiki|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
[wiki|Domains]
[wiki|S4 RNA-binding domain] (aa 12-69) (according to UniProt)
Structure
[AF|P05650]
Expression and Regulation
Operons
genes
[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2987848], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]→[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]

2022-09-13 21:19:35

Jstuelk

36

7cfa0ee36064fef3f7a603b125c665e7c80f35bd

A6120E836ADBF13F415EC7E80D314C2CE36E1D65

Biological materials
Mutant
MGNA-B879 (yaaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1878 NBRP B. subtilis, Japan]
BKE00030 (Δ[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGACCTCTTTCA,  downstream forward: _UP4_GTCAATTAAAGCGGGTGACA
BKK00030 (Δ[gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGACCTCTTTCA,  downstream forward: _UP4_GTCAATTAAAGCGGGTGACA
References
2987848,24637032,34846166

FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237

Page visits: 3732

Time of last update: 2022-10-03 15:56:39

Author of last update: Jstuelk