opuAA

opuAA
168

glycine betaine and arsenobetaine [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_02980
Molecular weight
46.28 kDa
pI
5.11
Protein length
Gene length
function
compatible solute transport
product
glycine betaine and arsenobetaine [wiki|ABC transporter] (ATP-binding protein)
essential
no
ec
3.6.3.32
synonyms
opuAA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4175

This gene is a member of the following regulons

Gene
Coordinates
321,013 → 322,269
The protein
Catalyzed reaction/ biological activity
uptake of glycine betaine and arsenobetaine [pubmed|29159878]
uptake of dimethylglycine [Pubmed|24561588]
ATP + H2O + quaternary ammonium --> ADP + H+ + phosphate + quaternary ammonium (according to UniProt)
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
2 [wiki|CBS domain]s (aa 284-340, aa 344-403) (according to UniProt)
[wiki|ABC transporter domain] (aa 34-270) (according to UniProt)
Structure
[PDB|3DHW] (MetN from E. coli, corresponds to aa 10 ... 272, 36% identity) [pubmed|18621668]
[AF|P46920]
Paralogous protein(s)
[protein|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA], [protein|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]
[wiki|Localization]
associated to the membrane (via [protein|5F989C57010ACFC03E37AF5A894153F432520921|opuAB]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]-[gene|5F989C57010ACFC03E37AF5A894153F432520921|opuAB]-[gene|546407EFD8128D1F74443991B8D600F668FBD7A1|opuAC]
description
[Pubmed|22383849]
regulation
induced by osmotic stress [Pubmed|23175650]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23175650], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]→[gene|546407EFD8128D1F74443991B8D600F668FBD7A1|opuAC]

2022-09-26 00:14:10

ghost

30

eafb0a634093d79d1a26ed7a049acac8747a3e05

204CCFDF8D1DFA897A97ACEDDC7D4A3EDDBDB61A

Biological materials
Mutant
GP3618 (spec), available in [wiki|Jörg Stülke]'s lab
BKE02980 (Δ[gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTCCATATTA,  downstream forward: _UP4_CCTTCTGCACAGGAGGTGAA
BKK02980 (Δ[gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTCCATATTA,  downstream forward: _UP4_CCTTCTGCACAGGAGGTGAA
Expression vectors
pGP2924 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
References
Reviews
27935846
Original Publications
7622480,10092453,16645306,14623183,18321243,16225868,21296969,22383849,23175650,23646920,24561588,29159878,18621668

FB2220730013A98D7C979062A4A451518B92DF09

Page visits: 1865

Time of last update: 2022-10-03 15:46:43

Author of last update: MBenda