youB

youB
168

unknown

locus
BSU_21329
Molecular weight
6.50 kDa
pI
9.101
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
youB

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

The protein
Structure
[AF|Q9K3A9]
Paralogous protein(s)
[protein|CC9FD5D0543E506758F11F9048F6A8ECD737D1A9|ydzM], (the sequences of the two proteins are identical)
Biological materials
Mutant
BKE21329 (Δ[gene|FB3DA9FBDE088A95E76E0FB83B1B1E8B53EC2FC1|youB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21329 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACTCCCCCGTTTA,  downstream forward: _UP4_TAAGGTGTAACACAAGGAGG
BKK21329 (Δ[gene|FB3DA9FBDE088A95E76E0FB83B1B1E8B53EC2FC1|youB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21329 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACTCCCCCGTTTA,  downstream forward: _UP4_TAAGGTGTAACACAAGGAGG

FB3DA9FBDE088A95E76E0FB83B1B1E8B53EC2FC1

Page visits: 1830

Time of last update: 2022-12-03 21:11:45

Author of last update: Bzhu