SubtiWiki SubtiWiki
yojE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yojE
168

unknown

locus
BSU_19480
Molecular weight
33.23 kDa
pI
10.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yojE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2962

This gene is a member of the following regulons

Gene
Coordinates
2,123,026 → 2,123,922
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 17-148, aa 162-286) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]-[gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
description
[Pubmed|23894131]
regulation
''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23894131], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]→[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]

2021-11-18 07:29:16

ghost

8

8005c717823da3d26388a7c7eb8015403326f861

6896F6A609EE8E15A33B13727D3C844A671832BA

Biological materials
Mutant
MGNA-B430 (yojE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1429 NBRP B. subtilis, Japan]
BKE19480 (Δ[gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATATCCCTGCCTTTC,  downstream forward: _UP4_TGAGGCCTTTGGCTTTTCAG
BKK19480 (Δ[gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATATCCCTGCCTTTC,  downstream forward: _UP4_TGAGGCCTTTGGCTTTTCAG
References
23894131

FBF1A8C92149A216D8A46F9E02898D7C5C448E2A

Page visits: 953

Time of last update: 2022-01-16 09:22:53

Author of last update: Melvin.boenninger