SubtiWiki SubtiWiki
sr1

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

sr1
168

small regulatory RNA controlling [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] and [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] expression, regulatory peptide

locus
BSU_14629
Molecular weight
4.00 kDa
pI
4
function
control of arginine metabolism, glycolysis, and sporulation
product
small regulatory RNA, regulatory peptide
essential
no
synonyms
ykzW, ykzW, sr1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,534,120 → 1,534,239
RNA
Catalyzed reaction/ biological activity
hybridizes to [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] and [gene|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] mRNA and inhibits [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] and [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] translation [Pubmed|34478554,17020585]
[wiki|Interactions]
[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA [Pubmed|20444087]
[gene|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] mRNA-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA [Pubmed|34478554]
[protein|93F328524989597C7D2329B25E665496C9631E87|csrA]-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA to promote base pairing between the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA and to control arginine metabolism [pubmed|31043113]
The peptide
Catalyzed reaction/ biological activity:
the peptide controls the stability of the ''[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' mRNA [Pubmed|20444087]
Protein family
the peptide is conserved in bacilli
[wiki|Interactions]
[protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]-[protein|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] [Pubmed|20444087]
Expression and Regulation
Operons
genes
[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]
description
[Pubmed|16164558]
regulation
Repressed in the presence of glucose by [protein|search|CcpN] [Pubmed|16164558]
regulatory mechanism
[protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]: repression, in [regulon|protein:2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16164558], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]

2022-01-25 02:04:52

ghost

7

cdd456f4f9f38239a8bd6de828c368acd2ff9101

6108D4013417F4507B07624F8909708801FA3461

Biological materials
Mutant
168 ykzW::cat, available in [wiki|Sabine Brantl]'s lab
GP2210 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''cat''), available in [wiki|Jörg Stülke]'s lab
GP2215 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab
GP2216 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''phleo''), available in [wiki|Jörg Stülke]'s lab
BKE14629 (Δ[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14629 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTATTCCCCATTTC,  downstream forward: _UP4_TAAAAAAAAGCATGCGGCTT
BKK14629 (Δ[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14629 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTATTCCCCATTTC,  downstream forward: _UP4_TAAAAAAAAGCATGCGGCTT
labs
[wiki|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]
References
Reviews
27750368,30191807,32850966,34066298,34576762
Original Publications
16164558,17020585,17576690,20444087,23034808,27449348,28818119,31043113,34478554

FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A

Page visits: 2366

Time of last update: 2022-01-26 10:08:59

Author of last update: Jstuelk