cwlK

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

cwlK
168

peptidoglycan hydrolytic L,D-endopeptidase

locus
BSU_02810
Molecular weight
18.97 kDa
pI
5.66
Protein length
Gene length
function
cell wall turnover
product
peptidoglycan hydrolytic L,D-endopeptidase
essential
no
synonyms
cwlK, ycdD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
303,804 → 304,307
The protein
Catalyzed reaction/ biological activity
cleaves the peptide bond between L-Ala (position 1 in the peptioglycan peptide) and D-Glu (position 2) [Pubmed|18266855]
Protein family
peptidase M15C family (single member, according to UniProt)
Structure
[PDB|6AKV] (from Bacillus phage B4, correpsonds to aa 61 ... 164, 51% identity) [pubmed|30518175]
[AF|O34360]
[wiki|Localization]
cell membrane [Pubmed|17588176]
Biological materials
Mutant
BKE02810 (Δ[gene|FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB|cwlK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGGTCTCACTTTCTC,  downstream forward: _UP4_GAGATGATTCCTAACTAGAC
BKK02810 (Δ[gene|FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB|cwlK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGGTCTCACTTTCTC,  downstream forward: _UP4_GAGATGATTCCTAACTAGAC
labs
[wiki|Ciaran Condon], IBPC, Paris, France [http://www.ibpc.fr/UPR9073/condon/index_en.html Homepage]
References
Reviews
18266855
Original Publications
17588176,30518175

FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB

Page visits: 1514

Time of last update: 2022-05-19 01:51:14

Author of last update: Jstuelk