SubtiWiki SubtiWiki
yceK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yceK
168

similar to transcriptional regulator ([wiki|ArsR family])

locus
BSU_02970
Molecular weight
11.35 kDa
pI
8.89
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yceK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0640

This gene is a member of the following regulons

Gene
Coordinates
320,421 → 320,723
The protein
Protein family
[wiki|ArsR family]
[wiki|Domains]
[wiki|HTH arsR-type domain] (aa 8-100) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yceK.html DBTBS]) null
Open in new tab

[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]

2020-11-06 12:56:32

ghost

0

e5826cdff29c6b2a2d0f3dbc422bcb73593644d8

3C23FF8BB4D1B399EECAD34F7BD98E18800339DB

Biological materials
Mutant
MGNA-C114 (yceK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2112 NBRP B. subtilis, Japan]
TMB150 (''yceK''::''spc''), available in [wiki|Erhard Bremer]'s lab [Pubmed|23175650]
BKE02970 (Δ[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGTGTTGAAAAAG,  downstream forward: _UP4_TAACAAAGGGTTTTCTCTAT
BKK02970 (Δ[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGTGTTGAAAAAG,  downstream forward: _UP4_TAACAAAGGGTTTTCTCTAT
References
23175650,23504016

FCFC26903EAEAC7264D1DA035CB407B221F3E735

Page visits: 971

Time of last update: 2022-01-18 10:55:04

Author of last update: Melvin.boenninger