SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


ABC-type antimicrobial peptide transporter (permease) for the export of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin

Molecular weight
41.55 kDa
Protein length
Gene length
resistence against [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
ABC-type antimicrobial peptide exporter (permease)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0845

This gene is a member of the following regulons

1,504,282 → 1,505,415
The protein
Protein family
[wiki|Membrane fusion protein (MFP) (TC 8.A.1) family] (according to UniProt)
[PDB|4DK0] (from Actinobacillus actinomycetemcomitans, 24% identity) [pubmed|22308040]
membrane protein with a large extracytoplasmic domain  [Pubmed|22707703]
Expression and Regulation
Open in new tab


2021-11-02 00:42:35





repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab


2021-11-16 05:55:10





Biological materials
MGNA-B349 (yknX::erm), available at the [ NBRP B. subtilis, Japan]
BKE14350 (Δ[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGATCCAGACTTTTTTCA,  downstream forward: _UP4_GACGGAATGGAAGTGAAATC
BKK14350 (Δ[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGATCCAGACTTTTTTCA,  downstream forward: _UP4_GACGGAATGGAAGTGAAATC


Page visits: 1374

Time of last update: 2022-01-17 21:58:59

Author of last update: Jstuelk