iolH

iolH
168

unknown, may be involved in myo-inositol catabolism

locus
BSU_39690
Molecular weight
33.37 kDa
pI
4.99
Protein length
Gene length
function
unknown, may be involved in myo-inositol catabolism
product
unknown
essential
no
ec
null
synonyms
iolH, yxdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1082

This gene is a member of the following regulons

Gene
Coordinates
4,074,896 → 4,075,765
The protein
Structure
[AF|P42418]
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2022-09-02 17:46:00

ghost

32

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B699 (iolH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1698 NBRP B. subtilis, Japan]
BKE39690 (Δ[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATATTTTCACTCCTCT,  downstream forward: _UP4_TAAGCTGAGCATGGAGTTCG
BKK39690 (Δ[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATATTTTCACTCCTCT,  downstream forward: _UP4_TAAGCTGAGCATGGAGTTCG
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,9887260,18310071

FD64E9D00BB03B510C7F7CA3935558A2195532A9

Page visits: 1174

Time of last update: 2022-09-28 13:14:43

Author of last update: Bzhu