SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


[wiki|ABC transporter ](ATP-binding protein, exporter) for the export of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin

Molecular weight
25.12 kDa
Protein length
Gene length
resistance to [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
[wiki|ABC transporter ](ATP-binding protein, exporter)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

1,505,416 → 1,506,108
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|ABC transporter domain] (aa 2-230) (according to UniProt)
[PDB|1L2T] (from Methanocaldococcus jannaschii, 52% identity) [pubmed|12150914]
Paralogous protein(s)
[protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
membrane associated (via [protein|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]) [Pubmed|10092453]
Expression and Regulation
Open in new tab


2021-11-02 00:42:35





repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab


2021-11-16 05:55:10





Biological materials
MGNA-B350 (yknY::erm), available at the [ NBRP B. subtilis, Japan]
BKE14360 (Δ[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCGCACATTAGAAAGCTGAA,  downstream forward: _UP4_TCCGGACAAAGGAGTGTGGG
BKK14360 (Δ[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCGCACATTAGAAAGCTGAA,  downstream forward: _UP4_TCCGGACAAAGGAGTGTGGG


Page visits: 1209

Time of last update: 2022-01-14 15:50:17

Author of last update: Melvin.boenninger