yknY

yknY
168

[wiki|ABC transporter ](ATP-binding protein, exporter) for the export of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin

locus
BSU_14360
Molecular weight
25.12 kDa
pI
5.82
Protein length
Gene length
function
resistance to [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
product
[wiki|ABC transporter ](ATP-binding protein, exporter)
essential
no
synonyms
yknY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

Gene
Coordinates
1,505,416 → 1,506,108
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 2-230) (according to UniProt)
Structure
[PDB|1L2T] (from Methanocaldococcus jannaschii, 52% identity) [pubmed|12150914]
[AF|O31711]
Paralogous protein(s)
[protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
membrane associated (via [protein|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]-[gene|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV]-[gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
description
[Pubmed|22383849]
Open in new tab

[gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]→[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]

2022-11-15 17:13:12

Jstuelk

19

974e58c669e1cd698f882bd9e9cd9cf65b440ca0

2DDBCA4C4ACA22DB6536DC6ACAC265E497334729

genes
[gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
description
[Pubmed|9987136]
regulation
repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|916419C4ED113778488EBC558A35810498028B02|yknW]→[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]

2022-11-22 16:03:56

ghost

25

8e304f408425d6f34ae03472458263e5418cf4c1

6245A3EE9A735006B93C2157E2EB2D4ED6006306

Biological materials
Mutant
MGNA-B350 (yknY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1349 NBRP B. subtilis, Japan]
BKE14360 (Δ[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCGCACATTAGAAAGCTGAA,  downstream forward: _UP4_TCCGGACAAAGGAGTGTGGG
BKK14360 (Δ[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCGCACATTAGAAAGCTGAA,  downstream forward: _UP4_TCCGGACAAAGGAGTGTGGG
References
10092453,16629676,9987136,12076816,12150914

FE3A01BEA974C5E32C68DC600C800E5EF101B34F

Page visits: 1728

Time of last update: 2022-11-27 03:38:15

Author of last update: Melvin.boenninger