gsiB

gsiB
168

general stress protein, prevents enzyme inactivation upon freeze-thaw treatments

locus
BSU_04400
Molecular weight
13.66 kDa
pI
5.14
Protein length
Gene length
function
response to water deficits
product
general stress protein
essential
no
synonyms
gsiB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3729

This gene is a member of the following regulons

Gene
Coordinates
494,506 → 494,877
The protein
Structure
[PDB|3JQH] (human glycan binding receptor, 31% identity) [pubmed|19835887]
[AF|P26907]
Expression and Regulation
Operons
genes
[gene|FE56282883B3229D3D6836A1BE7EA4292D3CC799|gsiB]
description
[Pubmed|1378051]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [Pubmed|11157964], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|FE56282883B3229D3D6836A1BE7EA4292D3CC799|gsiB]

2022-11-29 21:10:03

ghost

14

878d6e514625257bb17c134fdde400baca4c123b

D9F2B2898F488EEDD453E1C8209C71AD46D7AD07

Biological materials
Mutant
1A735 ( ''gsiB''::''kan''), [Pubmed|1378051], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A735&Search=1A735 BGSC]
BKE04400 (Δ[gene|FE56282883B3229D3D6836A1BE7EA4292D3CC799|gsiB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAATTCCTCCTTTA,  downstream forward: _UP4_TAATCAAAAGCATAAAGGCA
BKK04400 (Δ[gene|FE56282883B3229D3D6836A1BE7EA4292D3CC799|gsiB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAATTCCTCCTTTA,  downstream forward: _UP4_TAATCAAAAGCATAAAGGCA
References
9669336,12884008,7651322,11544224,1378051,21421783,23861025,11918677,19835887,29914988

FE56282883B3229D3D6836A1BE7EA4292D3CC799

Page visits: 4124

Time of last update: 2022-12-05 19:06:47

Author of last update: Jstuelk