motB

motB
168

H+-coupled [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB] flagellar stator

locus
BSU_13680
Molecular weight
29.33 kDa
pI
6.65
Protein length
Gene length
function
[category|SW.4.1.1|Motility and chemotaxis]
product
flagellar stator subunit
essential
no
synonyms
motB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1360

This gene is a member of the following regulons

Gene
Coordinates
1,433,676 → 1,434,461
Phenotypes of a mutant
increased [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P formation, resulting in reduced [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] expression and strongly reduced [wiki|genetic competence] [pubmed|28800172]
loss of swimming and swarming motility [Pubmed|24296669]
mucoid phenotype due to the [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P activated overexpression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon and resulting overproduction of poly-gamma-glutamate [Pubmed|24296669,23888912]
The protein
Protein family
MotB family (with [protein|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS], according to UniProt)
Structure
[wiki|6YSF] (the [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]5-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]2 complex from Clostridium sporogenes) [pubmed|32929189]
[PDB|4B62] (from Pseudomonas aeruginosa, corresponds to aa 110 ... 255, 33% identity)
[AF|P28612]
Modification
protonation of Asp-24 is essential for torque generation [Pubmed|23888912,9573160]
Paralogous protein(s)
[protein|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS]
[wiki|Localization]
anchored to the cell wall, extending through the cell membrane [pubmed|29196522]
Expression and Regulation
Operons
genes
[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]-[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]
description
[Pubmed|6313226]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|6313226], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]→[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]

2022-06-18 10:18:52

ghost

22

f511063e389d3698178011e8d1f147d1a31d3316

AF120FAC2CA2C8D759F36B320DEAC937613576A3

Biological materials
Mutant
available in [wiki|Nicola Stanley-Wall]'s lab [Pubmed|23888912]
BKE13680 (Δ[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCTCATGCTTCTTCTTCTTT,  downstream forward: _UP4_TAGCAAAAAAGGAAGCCTTG
BKK13680 (Δ[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCTCATGCTTCTTCTTCTTT,  downstream forward: _UP4_TAGCAAAAAAGGAAGCCTTG
References
Reviews
31136265,33163150
Original Publications
6313226,24296669,23888912,9573160,25273986,28378843,29061663,28800172,29109979,16095621,32929189,35499319

FE56753D061344B0F10A6523F49C5C7356AA40B6

Page visits: 2730

Time of last update: 2022-06-24 05:47:48

Author of last update: Jstuelk