ycbN

ycbN
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_02570
Molecular weight
31.54 kDa
pI
8.51
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
ycbN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1131

This gene is a member of the following regulons

Gene
Coordinates
280,086 → 281,009
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 5-233) (according to UniProt)
Structure
[PDB|4YER] (from Thermotoga maritima, corresponds to aa 4 ... 212, 40% identity)
[AF|P42246]
Expression and Regulation
Operons
genes
[gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]-[gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]-[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]-[gene|621FA6E2A76BB74F9051FBDB6857ED56F65BAB15|ycbO]
description
[pubmed|22383849]
Open in new tab

[gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]→[gene|621FA6E2A76BB74F9051FBDB6857ED56F65BAB15|ycbO]

2022-11-18 02:09:44

Jstuelk

17

77090242fa94fd81070f7200512e38f969f10d55

C42DE0C164AE1418C323B42BA4174D5584CA1EA2

Biological materials
Mutant
MGNA-C036 (ycbN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2034 NBRP B. subtilis, Japan]
BKE02570 (Δ[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTTTGTTTCTCCTTCCC,  downstream forward: _UP4_GCGTAAAGGAGGAGAGACAC
BKK02570 (Δ[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTTTGTTTCTCCTTCCC,  downstream forward: _UP4_GCGTAAAGGAGGAGAGACAC
References
10092453

FE7AC936BE959D745FBB6A88EAD64408C7177125

Page visits: 1303

Time of last update: 2022-11-27 02:37:15

Author of last update: Jstuelk