lutA

lutA
168

lactate catabolic enzyme

locus
BSU_34050
Molecular weight
26.24 kDa
pI
6.25
Protein length
Gene length
function
lactate utilization
product
lactate oxidase
essential
no
synonyms
lutA, yvfV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0247

This gene is a member of the following regulons

Gene
Coordinates
3,494,985 → 3,495,701
Phenotypes of a mutant
no growth with lactate as the single carbon source [Pubmed|19201793]
The protein
Catalyzed reaction/ biological activity
oxidation of lactate to pyruvate [Pubmed|19201793]
Protein family
LutA/YkgE family (single member, according to UniProt)
Structure
[PDB|5ODC] (from Methanothermococcus thermoautotrophicus, 24% identity) [pubmed|28818947]
[AF|O07020]
Expression and Regulation
Operons
genes
[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]
description
[Pubmed|19201793]
regulation
induction by lactate [Pubmed|19201793]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|19201793], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]→[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]

2022-09-16 23:46:13

ghost

14

7db2bc789fad5a99442f7b9ff99a43f2b42b4a12

59CEB598935063C72EA3D1BE77C54FD6CCE3442E

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|22427629]
[protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]: translation inhibition
Biological materials
Mutant
MGNA-A497 (yvfV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/497 NBRP B. subtilis, Japan]
BKE34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA,  downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
BKK34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA,  downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
lacZ fusion
GP1612 amyE::p(lutA-lacZ cat), constructed with pGP2149 based on [wiki|pAC5], available in [wiki| Jörg Stülke]'s lab
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
22427629,16430695,19201793,25031425,28818947

FEC83B66CEA311EA1650D61A215F82E9DF4E9F03

Page visits: 2665

Time of last update: 2022-09-28 08:50:50

Author of last update: Melvin.boenninger