lonA

lonA
168

class III heat-shock ATP-dependent protease

locus
BSU_28200
Molecular weight
86.42 kDa
pI
5.77
Protein length
Gene length
function
protein quality control, control of swarming motility
product
class III heat-shock ATP-dependent protease
essential
no
synonyms
lonA, lon

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0466

This gene is a member of the following regulons

Gene
Coordinates
2,880,466 → 2,882,790
Phenotypes of a mutant
presence of predifferentiated swarmer cells in liquid medium [Pubmed|25538299]
The protein
Catalyzed reaction/ biological activity
Hydrolysis of proteins in presence of ATP (according to UniProt)
inhibits swarming motility by preventing accumulation of SwrA in liquid medium [Pubmed|25538299]
Protein family
Peptidase S16 family (with [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP] and [protein|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB], according to UniProt)
[wiki|Domains]
Lon N-terminal (aa 9-200) (according to UniProt)
Lon proteolytic (aa 590-771) (according to UniProt)
Structure
[PDB|6U5Z] (from E. coli, 56% identity)
[PDB|5E7S] (active hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041593]
[PDB|4YPN] (ADP-bound hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041592]
[PDB|3M65] (N-terminal domain) [Pubmed|20600124]
[PDB|3M6A] (C-terminal domain) [Pubmed|20600124]
[PDB|1X37] (Ssd domain)
[AF|P37945]
[wiki|Localization]
coincident with the nucleoid during normal growth and localized to the forespore during development [Pubmed|18689473]
Expression and Regulation
Operons
genes
[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]-[gene|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|ysxC]
description
[Pubmed|7961402]
regulation
induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [Pubmed|9852015], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7961402], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]→[gene|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|ysxC]

2023-01-08 18:50:54

ghost

43

4cb14aa2acaf53ec467aec28bb01e2f09b1393ff

7EEAAFADAFDA76CE2520B524F32B86123E1933A6

Biological materials
Mutant
BKE28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT,  downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
BKK28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT,  downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
References
Reviews
23479438,26639779,34410368
Original Publications
7961403,7961402,19542270,19643080,9852015,18689473,20600124,25538299,27041592,27041593,29311275,34757797,35595098

FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC

Page visits: 2957

Time of last update: 2023-02-02 09:55:20

Author of last update: Jstuelk