SubtiWiki SubtiWiki
yyzE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yyzE
168

similar to [category|SW.1.2.2|PTS], EIIA component (truncated)

locus
BSU_40120
Molecular weight
8.11 kDa
pI
5.04
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yyzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2190

This gene is a member of the following regulons

Gene
Coordinates
4,122,619 → 4,122,849
The protein
Protein family
[category|SW.1.2.2|PTS] permease, glucose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIA domain] type-1 (aa 1-76) (according to UniProt)
Structure
[PDB|1AX3] (IIA domain of [protein|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG], 44% identity) [pubmed|9593197]
Expression and Regulation
Operons
genes
[gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]-[gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]
description
[pubmed|22383849]
Open in new tab

[gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]→[gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]

2022-01-25 10:23:04

Jstuelk

7

8bd365e0094c8dcdaf1e46e0911dfd4affbab9a2

80E316D455FD380B4088EF3C6251D2530EBCA95E

Biological materials
Mutant
BKE40120 (Δ[gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACAACCGTAATGACGC,  downstream forward: _UP4_GTCGTAAGCTGAGGAGGAAT
BKK40120 (Δ[gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACAACCGTAATGACGC,  downstream forward: _UP4_GTCGTAAGCTGAGGAGGAAT
References
10627040,9593197

FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81

Page visits: 1011

Time of last update: 2022-01-26 07:32:32

Author of last update: Melvin.boenninger