feuA

168

[wiki|ABC transporter] for the siderophores Fe-enterobactin and Fe-bacillibactin (binding protein), with [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV] as ATPase

locus: BSU_01630

Molecular weight: 34.95 kDa

pI: 8.02

Protein length: 317 aa

Gene length: 954 bp

function: [wiki|acquisition of iron]

product: [wiki|ABC transporter] for the siderophores Fe-enterobactin and Fe-bacillibactin (binding protein) [pubmed|28283524]

essential: no

synonyms: feuA

List of homologs in different organisms, belongs to COG0614 (Galperin et al., 2021)

Gene

Coordinates: 182,370  183,323

Phenotypes of a mutant

• severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C [pubmed|36312962]

Advertisement

The protein

Protein family

• [wiki|Bacterial solute-binding protein 8 family] (according to UniProt)

[wiki|Domains]

• Two independent non-symmetric globular domains, connected by a long alpha-helix (residues 143-164 of the mature protein).
• [wiki|Fe/B12 periplasmic-binding domain] (aa 57-317) (according to UniProt)

Structure

• [PDB|2PHZ], [PDB|2WI8], [PDB|2WHY] (complex with ferri-bacillibactin)
• [PDB|2XUZ] (complex with ferri-enterobactin)
• [PDB|2XV1] (complex with ferric mecam)
• [AF|P40409]

Modification

• FeuA is a lipoprotein with a N-acetyl-S-diacyl-glyceryl-cysteine structure  [Pubmed|22303020]

[wiki|Localization]

• associated to the membrane (lipoprotein) [Pubmed|22303020]
• extracellular (signal peptide) [Pubmed|18957862]

Expression and Regulation

Other regulations

• [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: translation control

Biological materials

Mutant

• BKE01630 ([gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAGAGCCTCCTGTT,  downstream forward: _UP4_AACTAATTCAGAGTAGGTTT
• BKK01630 ([gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAGAGCCTCCTGTT,  downstream forward: _UP4_AACTAATTCAGAGTAGGTTT

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab

References

• 20086155,19746494,19673474,14563870,16672620,10092453,16889643,17725565,12354229,18957862,18763711,22303020,10468622,28283524,29133393,31113899,36312962