ypqP

168

C-terminal part of the split gene spsM (together with [gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]), legionaminic acid synthesis, in B. subtilis 168 the gene is disrupted by the [category|SW.5.1.2|SP-beta prophage]

locus: BSU_21670

Protein length: 202 aa

Gene length: 606 bp

function: legionaminic acid synthesis

product: UDP-NAcGlcA inverting 4,6-dehydratase (C-terminal part)

essential: no

synonyms: ypqP, spsM

Gene

Coordinates: 2,286,448 → 2,287,053

Phenotypes of a mutant

• the [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP] mutant of PY79 has a less hydrophobic spore surface [pubmed|32817102]

Advertisement

The protein

Catalyzed reaction/ biological activity

• SpsM catalyzes the C-4/C-6 dehydration of the UDP-GlcNAc to produce UDP-4-keto-6-deoxy-GlcNAc, this is the first reaction of the legionaminic acid biosynthesis pathway [pubmed|32817102]
• required for spore crust assembly, legionaminic acid synthesis [pubmed|32817102]

[wiki|Domains]

• SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]

Structure

• [PDB|6BWC] (from B. thuringiensis, 39% identity) [pubmed|29266550]

Paralogous protein(s)

• [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC], (for SpsM)

Biological materials

Mutant

• MGNA-A061 (ypqP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/61 NBRP B. subtilis, Japan]
• BKE21670 (Δ[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGATACAGCTTTATCTGTTT,  downstream forward: _UP4_TAAAAACAAGCCTGTCTATC
• BKK21670 (Δ[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGATACAGCTTTATCTGTTT,  downstream forward: _UP4_TAAAAACAAGCCTGTCTATC

References

• 25299644,25326298,28535266,29266550,32817102,33803642