bacG

168

short chain reductase involved in bacilysin synthesis

locus: BSU_37680

Molecular weight: 27.87 kDa

pI: 6.6

Protein length: 259 aa

Gene length: 780 bp

function: biosynthesis of the antibiotic bacilysin

product: short chain reductase

essential: no

synonyms: bacG, ipa-86r, ywfH

List of homologs in different organisms, belongs to COG1028 (Galperin et al., 2021)

Gene

Coordinates: 3,867,493 → 3,868,272

The protein

Catalyzed reaction/ biological activity

• BacG catalyzes the conjugate addition of hydride at the C4 olefinic terminus using NADH to yield the cyclohexenol- containing tetrahydro-4-hydroxyphenylpyruvate [Pubmed|20052993]
• stereoselective reduction of dihydro-hydroxyphenylpyruvate (H2HPP) to tetrahydro-hydroxyphenylpyruvate (H4HPP), NADPH-dependent reductase that facilitates the conjugate addition of a hydride at the C(4) olefin terminus of H2HPP [Pubmed|23519407]

Protein family

• [wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)

[wiki|Cofactors]

• NADPH [Pubmed|23519407]

Structure

• [PDB|3U49] [Pubmed|23519407]
• [AF|P39644]

Expression and Regulation

Operons

• genes: [gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]

  description: [Pubmed|12372825]

  regulation

  • repressed by casamino acids [Pubmed|12107147]

  regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]

Biological materials

Mutant

• MGNA-A515 (ywfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/515 NBRP B. subtilis, Japan]
• BKE37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG,  downstream forward: _UP4_AGCATATAAAAACATCCCGC
• BKK37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG,  downstream forward: _UP4_AGCATATAAAAACATCCCGC

References

• 12372825,12107147,20052993,21948839,23519407