yfhS
168
sporulation gene
locus
BSU_08640
Molecular weight
8.66 kDa
pI
5.84
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfhS
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
936,773 936,997
Phenotypes of a mutant
reduced cell size [pubmed|32699122]
suppression of the growth defect caused by overexpression of [protein|5E5894ABD87B095191B109CEA9CEA89A5CA8A82D|ypsA] [pubmed|32699122]
The protein
Structure
[AF|O31585]
Expression and Regulation
Operons
genes
[gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]
description
[Pubmed|10463184]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [pubmed|10463184], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Biological materials
Mutant
MGNA-C323 (yfhS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2321 NBRP B. subtilis, Japan]
BKE08640 ([gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAAGACCCCCTTT, downstream forward: _UP4_CGCGTCTCTTACGATTAAGA
BKK08640 ([gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAAGACCCCCTTT, downstream forward: _UP4_CGCGTCTCTTACGATTAAGA
References
Page visits: 3497
Time of last update: 2025-10-24 06:15:54
Author of last update: Jstuelk