scoC

scoC
168

transcriptional repressor of genes expressed in the transition phase

locus
BSU_09990
Molecular weight
23.57 kDa
pI
5.19
Protein length
Gene length
function
transition state regulator
product
transcriptional repressor ([wiki|MarR family])
essential
no
synonyms
scoC, hpr, catA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
1,073,106 → 1,073,717
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 13-157) (according to UniProt)
Structure
[PDB|2FXA]
[AF|P11065]
Modification
phosphorylated on Arg-3 [Pubmed|22517742]
Effectors of protein activity
activity is inhibited in an unknown way by [protein|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|prkA] (possibly phosphorylation) [Pubmed|25983726]
DNA binding is affected by [protein|D3F00747006D974A8635D4391E0C261A3276E6AB|dnmA]-mediated DNA methylation [pubmed|32324221]
Expression and Regulation
Operons
genes
[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]
description
[Pubmed|3131303]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|2504584]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|2504584], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]: activation, in [regulon|protein:69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS regulon]
[protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]: repression, in [regulon|protein:8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|19251843], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]

2022-06-26 06:05:57

ghost

15

17215b77db375619c1d2254ccea07ee5e40cf918

007F17A7AA4F3B0C0B799098893141828905D34E

Biological materials
Mutant
1A918 ( ''scoC''::''erm  trpC2 leuC7''), [Pubmed|15126467], available at the [http://bgsc.org/getdetail.php?bgscid=1A918 Bacillus Genetic Stock Center]
BKE09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC,  downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
BKK09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC,  downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [wiki|Ulf Gerth]'s lab
References
Reviews
28886686
Original Publications
3131303,16923912,1906467,10383984,16321961,14629015,1907636,15126467,2504584,15104138,19118355,19801406,19898538,20382764,22517742,23660663,11717292,25966844,19251843,26473603,25983726,26728191,31039790,32324221

F7FD94CE7AB290FBFD3A9B88F204961668F9B42C

Page visits: 6179

Time of last update: 2022-07-02 01:52:21

Author of last update: Jstuelk