SubtiWiki SubtiWiki
ysmB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ysmB
168

similar to transcriptional regulator (MarR family)

locus
BSU_28400
Molecular weight
17.00 kDa
pI
6.51
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ysmB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
2,904,043 → 2,904,483
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 9-141) (according to UniProt)
Structure
[PDB|2RDP] (Geobacillus stearothermophilus)
Expression and Regulation
Operons
genes
[gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]-[gene|36FF9F097682D8BA8D7359BFEAF71ACE8E9E90D8|racE]
description
[Pubmed|22383849]
Open in new tab

[gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]→[gene|36FF9F097682D8BA8D7359BFEAF71ACE8E9E90D8|racE]

2021-10-31 20:13:17

ghost

7

f5e4f8ee31f04301223ca86fefb4a0124b1353e1

ECD5050BEE6E10F29E2E5EB1C377C6316A85AAA0

Biological materials
Mutant
MGNA-B016 (ysmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1015 NBRP B. subtilis, Japan]
BKE28400 (Δ[gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCCATCCCTCACTC,  downstream forward: _UP4_GAAATGAAGAGAAAATGAGG
BKK28400 (Δ[gene|FBD63332ABDEA7D4837396A0617DA51153781CFE|ysmB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCCATCCCTCACTC,  downstream forward: _UP4_GAAATGAAGAGAAAATGAGG
References
22383849

FBD63332ABDEA7D4837396A0617DA51153781CFE

Page visits: 879

Time of last update: 2022-01-21 14:17:43

Author of last update: Melvin.boenninger