ywdD
168
unknown
locus
BSU_38000
Molecular weight
18.30 kDa
pI
9.97
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywdD, ipa-54d
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
3,899,853 3,900,488
The protein
Structure
[AF|P39612]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
BKE38000 ([gene|1E915C58089172CE4658211DB32B11092C447A65|ywdD]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTTCGGATACATATG, downstream forward: _UP4_TGATTTTTTAGGTATATACA
BKK38000 ([gene|1E915C58089172CE4658211DB32B11092C447A65|ywdD]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTTCGGATACATATG, downstream forward: _UP4_TGATTTTTTAGGTATATACA
Page visits: 2554
Time of last update: 2025-10-28 13:12:46
Author of last update: Melvin.boenninger