speE
168
spermidine synthase, N1-aminopropylagmatine synthase
locus
BSU_37500
Molecular weight
31.18 kDa
pI
5.07
function
spermidine, polyamine biosynthesis
product
spermidine synthase
essential
no
ec
2.5.1.16
synonyms
speE, ywhF
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0421 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,848,786 3,849,616
Phenotypes of a mutant
inactivation of [gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE] reduces [wiki|sporulation] efficiency to 6% that of wild type cells; delayed entry into [wiki|sporulation] [Pubmed|26735940]
reduced survival after [category|SW.3.1.1|DNA replication] arrest imposed by inhibition of [protein|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC] activity [pubmed|36574412]
The protein
Catalyzed reaction/ biological activity
[metabolite|agmatine] + [metabolite|S-adenosyl-L-methioninamine] --> H+ + [metabolite|S-methyl-5'-thioadenosine] + N1-[metabolite|aminopropylagmatine] [pubmed|38588807]
Protein family
spermidine/spermine synthase family (single member, according to UniProt)
[wiki|Domains]
PABS domain (aa 3-236) (according to UniProt)
Structure
[PDB|1IY9]
[AF|P70998]
Expression and Regulation
Operons
genes
[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]-[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]
description
[Pubmed|9723923]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9723923], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
[wiki|Jörg Stülke]'s lab
Biological materials
Mutant
MGNA-A521 (ywhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/521 NBRP B. subtilis, Japan]
BKE37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::erm ), available in the BGSC and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
BKE37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG, downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
BKK37500 ([gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG, downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
Expression vectors
pGP3758: expression of Strep-''speE'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP3759: expression of ''speE''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
Page visits: 5177
Time of last update: 2025-10-23 16:39:10
Author of last update: Jstuelk