yetA

yetA
168

similar to exo-rhamnogalacturonan lyase

locus
BSU_07090
Molecular weight
97.39 kDa
pI
6.09
Protein length
Gene length
function
utilization of rhamnogalacturonan
product
putative exo-rhamnogalacturonan lyase
essential
no
synonyms
yetA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
776,834  779,407
The protein
Structure
[PDB|5XQG] (from Penicillium chrysogenum, 33% identity) [pubmed|29574769]
[AF|O31530]
Biological materials
Mutant
MGNA-B456 (yetA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1455 NBRP B. subtilis, Japan]
BKE07090 ([gene|5D709A74B628A23B3727BF1657168DB3E338AE49|yetA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCTCTCCCTCCATA,  downstream forward: _UP4_TAACAGCCGGAATTTCATAG
BKK07090 ([gene|5D709A74B628A23B3727BF1657168DB3E338AE49|yetA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCTCTCCCTCCATA,  downstream forward: _UP4_TAACAGCCGGAATTTCATAG
References
Research papers
29574769

5D709A74B628A23B3727BF1657168DB3E338AE49

Page visits: 2405

Time of last update: 2025-10-27 04:12:27

Author of last update: Jstuelk