yetA
168
similar to exo-rhamnogalacturonan lyase
locus
BSU_07090
Molecular weight
97.39 kDa
pI
6.09
function
utilization of rhamnogalacturonan
product
putative exo-rhamnogalacturonan lyase
essential
no
synonyms
yetA
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
776,834 779,407
The protein
Structure
[PDB|5XQG] (from Penicillium chrysogenum, 33% identity) [pubmed|29574769]
[AF|O31530]
Biological materials
Mutant
MGNA-B456 (yetA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1455 NBRP B. subtilis, Japan]
BKE07090 ([gene|5D709A74B628A23B3727BF1657168DB3E338AE49|yetA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCTCTCCCTCCATA, downstream forward: _UP4_TAACAGCCGGAATTTCATAG
BKK07090 ([gene|5D709A74B628A23B3727BF1657168DB3E338AE49|yetA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCTCTCCCTCCATA, downstream forward: _UP4_TAACAGCCGGAATTTCATAG
References
Research papers
Page visits: 2405
Time of last update: 2025-10-27 04:12:27
Author of last update: Jstuelk