yqaP
168
unknown
locus
BSU_26230
Molecular weight
34.63 kDa
pI
4.8
function
unknown
product
unknown
essential
no
synonyms
yqaP
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
2,691,642 → 2,692,571
The protein
Structure
[AF|P45913]
Expression and Regulation
Operons
genes
[gene|C1C11ED790D5552A275419DEE04250840CED6723|yqaP]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Biological materials
Mutant
BKE26230 (Δ[gene|C1C11ED790D5552A275419DEE04250840CED6723|yqaP]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAACAACCTCCACTAC, downstream forward: _UP4_TAACCTGCACATCCAAGCCG
BKK26230 (Δ[gene|C1C11ED790D5552A275419DEE04250840CED6723|yqaP]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAACAACCTCCACTAC, downstream forward: _UP4_TAACCTGCACATCCAAGCCG
References
Page visits: 2702
Time of last update: 2025-10-27 14:53:01
Author of last update: Bzhu